Справочник »» Подробно о лекарствах »» Акрихин »» Дерматология
 Здоровый образ жизни с современными технологиями Соглашение об использовании 

Опубликовано в журнале:
«Клиническая дерматология и венерология», 2008, № 5, с. 35-39

Клинико-иммунологические показатели у больных атопическим дерматитом при лечении препаратами линии акридерм

И.Я. Эртнеева1, Е.В. Матушевская2, Е.В. Свирщевская3
1Кожно-венерологический диспансер №27 Департамента здравоохранения Москвы, 2Российский государственный медицинский университет, 3Институт биоорганической химии им. М.М. Шемякина и Ю.В. Овчинникова РАН3ММА им. И. М. Сеченова, Москва

Clinico-immunologic indices in patients with atopic dermatitis over treatment with Akriderm preparations

I.YA. Ertneeva1, E.V. Matushevskaya2, E.V. Svirshchevskaya3
1Skin-Venereologic Dispensary №27 of Department of Public Health of Moscow, 2Russia state medical university, 3M.M. Shemyakin and Yu.V. Ovchinnikov Institute of bioorganic chemistry of the Academy of Science of Russia

В настоящее время под атопическим дерматитом (АД) понимают хроническое аллергическое заболевание, характеризующееся экссудативными и лихеноидными высыпаниями, повышенным уровнем иммуноглобулина класса Е (IgE) в сыворотке крови и гиперчувствительностью к специфическим раздражителям. Однако, как показано в ряде работ отечественных и зарубежных исследователей, лишь у некоторых больных повышен уровень общего и аллергенспецифического IgE, что позволяет отнести только этих больных к группе с IgE-опосредованным типом заболевания. У ряда больных не удается выявить IgE-опосредованную гиперчувствительность, однако обнаруживается гиперчувствительность замедленного типа [1]. Кроме этих двух групп выявляются больные, у которых в патогенезе принимают участие несколько типов аллергических реакций — группа смешанного типа. И, наконец, у ряда больных патогенез АД обусловлен другими, не иммунными механизмами [2]. Несмотря на успехи иммунологии и множество публикаций, посвященных участию иммунных механизмов в развитии АД, многие вопросы продолжают оставаться спорными и недостаточно изученными.

IgE-опосредованные реакции у больных АД описаны достаточно полно. В отличие от гуморального звена иммунитета, участие Т-клеток в патогенезе заболевания изучено в значительно меньшей степени. Показано, что в патогенезе аллергических заболеваний в целом основная роль принадлежит Т-хелперам 2-го типа, продуцирующим цитокины — интерлейкины (ИЛ)-4, -5, -10 и -13 — и отвечающих за переключение В-клеток на синтез IgE (ИЛ-4 и ИЛ-13) и эозинофилию (ИЛ-5). Участию Тх 1-го типа в патогенезе АД в последние годы уделяется значительно больше внимания. Основное внимание при изучении функциональных характеристик иммунной системы отводится вопросам регуляции синтеза IgE in situ в коже, роли Т-хелперов 1, 2 и 17 и синтезируемых ими цитокинов, а также роли Т-клеток-регуляторов и ряда молекул, экспресси-руемых кожей больных АД [3—10]. Исследования участия Т-клеток в патологических процессах, а также взаимосвязи гуморального и клеточного иммунитета при АД являются актуальными.

Лечение больных АД представляет сложную проблему для специалиста ввиду особенностей патогенеза заболевания, многообразия фенотипических проявлений и стадийного течения процесса [11—13]. Наружная терапия является неотъемлемой частью комплексного лечения этого заболевания, занимая в ней ведущее место. Основой современной терапии АД остаются наружные глюкокортикостероиды (ГКС). Существующие побочные эффекты от применения ГКС усиливают необходимость поиска новых кортикостероидных препаратов, отвечающих оптимальному соотношению эффективности и безопасности [1, 14—17].

Целью данной работы явились оценка клинической эффективности препаратов линии акридерм при лечении больных АД, а также анализ влияния продуктов данной линии — акридермов, содержащих бетаметазона дипропионат, на уровень общего IgE в сыворотке крови и уровень экспрессии лимфоцитами периферической крови (ЛПК) провоспалительных цитокинов, ассоциированных с аллергическими реакциями, ИЛ-5 и -13.

Материалы и методы

Клиническая характеристика больных

Под наблюдением находились 63 больных АД (42 мужчин и 21 женщин) в возрасте 23,5±5,6 года. Эритематозно-сквамозная (со слабой или умеренной лихенификацией) форма АД выявлена у 28 (45%) больных, лихеноидная — у 16 (25%), пруриго-подобная — у 12 (19%), экзематоидная — у 7(11%) (табл. 1). Тяжесть заболевания оценивали по следующим критериям: SCORAD <40 баллов — легкая форма, от 40 до 60 баллов — средняя форма; >60 баллов — тяжелая форма. У 24 (38%) пациентов была легкая форма заболевания, у 36 (57%) — средняя форма, у 3 (5%) — тяжелая форма заболевания. У 12 (19%) пациентов основной процесс был осложнен вторичной инфекцией. В исследование не были включены пациенты с гиперчувствительностью к бетаметазону, беременные женщины, а также больные, принимающие кортикостероиды и цитостатики. Длительность исследования составила 6—8 нед. Все больные получали только наружную терапию. Для лечения применяли препараты линии акридерм, которые выпускаются в виде различных лекарственных форм: акридерм крем и мазь, акридерм СК мазь, акридерм ГК крем, акридерм Гента крем.

Таблица 1. Клиническая эффективность препаратов линии акридерм у больных атопическим дерматитом

Результат лечения Степень тяжести Всего больных
легкая средняя тяжелая
Клиническая ремиссия 16 6 - 22 (35%)
Значительное улучшение 8 17 - 25 (40%)
Улучшение - 13 2 15 (24%)
Без эффекта - - 1 1 (1%)
Всего больных 24 36 3 63 (100%)

Действующим началом линии акридерм является бетаметазона дипропионат (БД) — β-изомер дексаметазона. БД обладает высокой местной противовоспалительной и антиаллергической активностью и не оказывает системного влияния, что связано с особенностями его химической структуры и метаболизма. Акридерм крем применяли у больных АД при остром воспалении без мокнутия, при подостром воспалении (эритема, отек, папулезные и пруриги-нозные элементы, экскориации и шелушение). Акридерм СК использовали у больных с поражениями кожи, сопровождающимися инфильтрацией и лихени-зацией. При подостром и хроническом течении, осложненном бактериальной и/или грибковой инфекцией, назначали акридерм ГК и акридерм Гента. Препараты линии акридерм наносили тонким слоем на пораженные участки кожи 2 раза в сутки (утром и вечером), после уменьшения воспалительных явлений было достаточно однократного применения препаратов. Продолжительность лечения составляла от 1 до 2—4 нед. Эффективность лечения оценивали по следующим критериям: клиническая ремиссия; значительное улучшение; улучшение; без эффекта.

Объективными параметрами клинической эффективности служили уменьшение выраженности кожной симптоматики заболевания или их полное разрешение, оцениваемое с помощью шкалы SCORAD.

Выделение лимфоцитов периферической крови

Лимфоциты выделяли из гепаринизированной периферической крови больных на градиенте фиколл—верографин (Sigma) по стандартной процедуре, рекомендованной производителем. Выделенные ЛПК отмывали 3 раза фосфатным буфером (ФБ) и переводили в культуральную питательную среду, которую готовили на основе среды RPMI-1640 с добавлением 10% инактивированной нагреванием сыворотки эмбрионов коровы, 300 мкг/мл L-глютамина, 50 мкмоль 2-меркаптоэтанола и 30 мкг/мл линкомицина. Для индукции экспрессии мРНК ЛПК питательную среду вносили по 5 млн/ лунку 24-луночного планшета и стимулировали 20 мкг/мл фитогемагглютинина (ФГА) в течение 24 ч при температуре 37°С и 5% СО2.

Анализ экспрессии мРНК ИЛ-5 и ИЛ-13

После окончания инкубации клетки отмывали ФБ и выделяли из них РНК в соответствии с описанной методикой [18]. Синтез кДНК проводили с помощью обратной ММТV транскриптазы (Бион, Москва). Анализ продукции мРНК ИЛ-5 и ИЛ-13 проводили стандартным методом полимеразной цепной реакции (ПЦР) с использованием специфичных праймеров для актина, ИЛ-5 и ИЛ-13. Анализ экспрессии гена β-актина использовали в качестве положительного контроля. Прямой и обратный праймеры для β-актина, ИЛ-5 и ИЛ-13 использовали следующие:

β-актин:

5’cactcttccagccttccttcc 3’

5’cggactcgtcatactcctgctt 3’

ИЛ-5:

5’-AGACCTTGGCACTGCTTTC-3’

5’-CTCTCCGTCTTTCTTCTCCAC-3’

ИЛ-13:

5’ CCATCGAGAAGACCCAGAGG 3’

5’ CCTGGGGTCCACTGCTTTAG 3’, 15, 20, 25 и 30.

Гель-электрофорез

Анализ продуктов ПЦР с обратной транскрипцией проводили с помощью горизонтального фореза в 1,5% агарозном геле, окрашенном бромистым этидием. Результаты реакции выявляли с помощью ультрафиолетового трансиллюминатора («Vilber Lourmat», Франция) и регистрировали с помощью цифровой камеры («Vilber Lourmat»). Появление полосы на 15-м цикле обозначали реакцией +4, на 20-м цикле — +3, на 25-м цикле — +2, на 30-м цикле — +1; отсутствие продукта — 0. Актин во всех случаях экспрессировался на уровне +4.

Статистическую обработку полученных данных проводили с помощью программы Excell по t-критерию Стьюдента.

Результаты и обсуждение

В результате проведенного лечения (табл. 1) состояние клинической ремиссии в виде исчезновения зуда и воспалительных изменений кожи было достигнуто в среднем через 3—4 нед после начала терапии у 16 (25%) больных с легкой степенью и у 6 (10%) больных со средней степенью тяжести заболевания. Значительное улучшение отмечалось у 8 (13%) пациентов с легкой и у 17 (27%) со средней степенью тяжести АД, что составило 40%. Улучшение было отмечено у 15 (24%) больных: у 13 (21%) со средней и у 2 (3%) — с тяжелой формой АД. У одного пациента с тяжелым течением заболевания эффект от лечения отсутствовал.

Таким образом, при применении наружных ГКС линии акридерм положительный клинический эффект наблюдался у 62 (98%) больных с преимущественно легкой и средней степенью тяжести заболевания. Пациентам без положительной динамики симптомов АД вне рамок настоящего исследования назначали дополнительно общепринятое лечение (антигистаминные, десенсибилизирующие, седативные, ферментные препараты).

Оценка регресса отдельных симптомов заболевания — эритемы, мокнутия, шелушения, лихенификации, зуда и жжения — позволила выявить высокую эффективность терапии. Число пациентов с выраженной эритемой сократилось с 38,1% до 0, а число случаев незначительного покраснения — с 34,9 до 9,5%. Лихенизация наблюдалась у 40 больных до начала лечения, на 5—7-й день отмечалось значительное уменьшение этого признака, у 10 больных сохранялась умеренная лихенизация, у 22 — лихенизация легкой степени. Через 14 дней лечения акридермом наблюдалась незначительная лихенизация у 14 больных. Из 49,2% пациентов, оценивавших зуд как интенсивный в начале лечения, только 4,7% не отметили его интенсивности после лечения. Другие симптомы (эритема, везикуляция, сухость) регрессировали в несколько меньшей степени. Таким образом, с учетом изменения клинических проявлений и локализации высыпаний под влиянием проводимого лечения акридерм можно рекомендовать больным с лихеноидной и пруригоподобной формах.

Соответственно данные препараты можно использовать в виде монотерапии у больных с легкой и средней степенью заболевания, а также в комплексной терапии у больных с тяжелым течением АД. Переносимость акридермов пациентами была хорошей, не было отмечено ни одного случая осложнений или побочного действия.

Для обоснованности эффективности применения акридермов провели изучение продукции цито-кинов Т-хелперов 2-го ряда (ИЛ-5 и ИЛ-13) и оценку уровня общего IgE в крови до и после лечения препаратами данной линии.

Влияние препаратов линии акридерм на продукцию ИЛ-5 и ИЛ-13

Анализ экспрессии матричной РНК ИЛ-5 и ИЛ-13 ЛПК у больных АД проводили до и после лечения методом ПЦР с обратной транскрипцией. ЛПК после выделения на градиенте плотности стимулировали конканавалином А в субоптимальной дозе и инкубировали в течение 24 ч. Результаты ПЦР оценивали полуколичественно (от 0 до +4) по времени появления продукта. Результаты анализа свидетельствовали, что при выбранном методе стимуляции ЛПК только у 8 (62%) из 13 больных регистрируется продукция цитокинов. Лечение акридермом приводило к снижению продукции цитокинов у 6 из 8 (75%) этих больных (табл. 2). Различий по значению SCORAD до и после лечения между группами с высокой и низкой продукцией цитокинов не было, что свидетельствует об эффективности препаратов, независимо от типа иммунного ответа.

Таблица 2. Продукция интерлейкина (ИЛ)-13 и -5 до и после лечения препаратами линии акридерм у больных атопическим дерматитом (АД)

№№
п/п
№№ больных SCORAD актин/ИЛ-13/ИЛ-5*
до лечения после лечения до лечения после лечения
1 2 3 4 5 6
1 АД64 26,8 7,9 4/2/1 4/2/1
2 АД100 63,4 18,9 4/3/2 4/2/3
3 АД91 18,5 5,3 4/2/2 4/1/0**
4 АД77 18,9 26,4 4/2/3 4/1/3**
5 АД80 31,3 15,1 4/3/3 4/1/1**
6 АД62 46,9 24,4 4/3/2 4/1/1**
7 АД78 40,2 10,6 4/2/2 4/2/2**
8 АД67 54,9 27,8 4/2/2 4/1/1**
Среднее±SD   39±17 17±9**    
9 АД68 27,8 9,9 2/0/1 4/0/2
10 АД69 60,3 32,9 2/0/0 4/0/0
11 АД66 30,3 17,8 4/0/1 4/0/2
12 АД65 28,4 8,0 3/0/0 4/0/0
13 АД76 33,0 12,4 2/0/0 4/0/0
Среднее±SD   34±13 16±10**    

Примечание. * — в столбце приведены данные по уровню экспрессии мРНК актина, ИЛ-5 и ИЛ-13. Актин использовали в качестве контроля. Максимальный уровень продукции принят за 4 балла, минимальный — за 0 баллов (см. раздел «Материалы и методы»). ** — достоверные изменения по сравнению с данными до лечения.

Изучение корреляции между продукцией цитокинов и уровнем общего IgE в сыворотке крови больных атопическим дерматитом

Состояние гуморального иммунитета больных АД оценивали путем определения уровня общего IgE в сыворотке крови. Результаты исследования общего циркулирующего IgE свидетельствовали о повышении его уровня у 8 (61,5%) из 13 обследованных больных (см. табл. 2). Доля больных, у которых выявляли повышенный уровень IgE в крови, в группе с повышенной продукцией цитокинов (75%) была выше, чем в группе, в которой продукция цитокинов была в норме (40%), хотя объем выборки не позволяет говорить о статистической значимости этих различий. По данным оценки уровня общего IgE в сыворотке крови больных АД, как с повышенной, так и с нормальной продукцией цитокинов, в этих группах дополнительно выделяются подгруппы с высоким и нормальным уровнями IgE. У больных с гиперпродукцией цитокинов заметна тенденция к формированию IgE-опосредованного АД, а у больных с нормальной продукцией цитокинов — к формированию не IgE-опосредованного АД.

Влияние лечения препаратами линии акридерм на уровень общего IgE в сыворотке крови больных АД

Анализ уровня общего IgE провели у 12 больных АД до и после лечения препаратами линии акридерм. Результаты анализа приведены в табл. 3. Повышенный уровень общего IgE в сыворотке крови до лечения выявили у 7 их 12 больных. У 5 из них уровень IgE достоверно снижался после лечения (р<0,05, t-критерий Стьюдента). Таким образом, БД способствует снижению общего уровня IgE у больных АД с повышенным уровнем IgE. Следует отметить, что даже в группе с исходно низким уровнем IgE в сыворотке крови наблюдается тенденция к его снижению после лечения (р=0,67). Различий по значению SCORAD между группами с высоким и нормальным уровнем IgE не было выявлено ни до, ни после лечения.

Таблица 3. Влияние лечения препаратами линии акридерм на уровень общего иммуноглобулина класса Е (IgE) в сыворотки крови больных атопическим дерматитом (АД)

№№
п/п
№№ больных SCORAD актин/ИЛ-13/ИЛ-5*
до лечения после лечения до лечения после лечения
1 АД64 26,8 7,9 3647 2580*
2 АД100 63,4 18,9 2092 1507*
3 АД91 18,5 5,3 1596 1485
4 АД68 27,8 9,9 1191 859*
5 АД69 60,3 32,9 552 420
6 АД69 60,3 32,9 292 178*
7 АД62 46,9 24,4 289 215*
Среднее±SD   43±19 19±12* 1380±1210 1035±878*
8 АД78 27,8 10,6 82 91
9 АД67 17,8 27,8 83 59
10 АД66 8,0 17,8 33 23
11 АД65 12,4 8,0 93 69
12 АД76 33,0 12,4 26 18
Среднее±SD   37±11 17±9* 63±31 32±31

Примечание. * — достоверные (t-критерий, р<0,05) отличия от значений до лечения.

Таким образом, препараты линии акридерм показаны для лечения всех иммунных форм АД, так как воздействуют на основные патогенетические звенья заболевания, а именно подавляют продукцию цитокинов, отвечающих за переключение В-клеток на синтез IgE и эзинофилию, и снижают уровень IgE в сыворотке крови больных. Препараты линии акридерм оказывают противовоспалительное, противозудное и противоаллергическое действие и эффективны при всех клинических формах АД и степенях тяжести заболевания. Клиническая эффективность препаратов линии акридерм при лечении больных АД составила 98% (62 пациента). В результате применения акридермов не было отмечено ни одного случая осложнений или развития побочных явлений системного характера. Высокая эффективность акридермов, отсутствие осложнений и побочных эффектов позволяют рекомендовать препараты этой линии для наружной терапии больных АД.

Работа выполнена при поддержке грантов Президента Российской Федерации для государственной поддержки ведущих школ Российской Федерации НШ-2077.2003.4 и НШ-4397.2008.7.

ЛИТЕРАТУРА
1. Матушевская Е.В., Богуш П.Г., Свирщевская Е.В. и др. Анализ аллергенспецифических IgE у больных атопическим дерматитом в Москве. Вестн дерматол венерол 2003; 2: 4—8.
2. Akdis C.A., Akdis M., Trautmann A. et al. Immune regulation in atopic dermatitis. Curr Opin Immunol 2000; 12: 6: 641—646.
3. Lipozencić J, Wolf R. Atopic dermatitis: an update and review of the literature. Dermatol Clin 2007; 25: 4: 605—612.
4. Staumont-Sallé D., Abboud G., Brénuchon C. et al. Peroxisome proliferator-activated receptor alpha regulates skin inflammation and humoral response in atopic dermatitis. J Allerg Clin Immunol 2008; 121: 4: 962—968.
5. Plager D.A., Leontovich A.A., Henke S.A. et al. Early cutaneous gene transcription changes in adult atopic dermatitis and potential clinical implications. Exp Dermatol 2007; 16: 1: 28—36.
6. Koga C., Kabashima K., Shiraishi N. et al. Possible Pathogenic Role of Th17 Cells for Atopic Dermatitis. Invest Dermatol. 2008 Apr 24. (in press).
7. van Beelen A.J., Teunissen M.B., Kapsenberg M.L. et al. Interleukin-17 in inflammatory skin disorders. Curr Opin Allergy Clin Immunol 2007; 7: 5: 374—381.
8. Reefer A.J., Satinover S.M., Solga M.D. et al. Analysis of CD25hiCD4+ «regulatory» T-cell subtypes in atopic dermatitis reveals a novel T(H)2-like population. J Allerg Clin Immunol 2008; 121: 2: 415—422.
9. Wang Y.H., Angkasekwinai P., Lu N. et al. IL-25 augments type 2 immune responses by enhancing the expansion and functions of TSLP-DC-activated Th2 memory cells. J Exp Med 2007; 204: 8: 1837— 18 47.
10. Ardern-Jones M.R., Black A.P., Bateman E.A., Ogg G.S. Bacterial su-perantigen facilitates epithelial presentation of allergen to T helper 2 cells. Proc Natl Acad Sci USA 2007; 104: 13: 5557—5562.
11. Суворова К.Н. Атопический дерматит: иммунопатогенез и стратегия иммунотерапии. Рус мед журн Спец выпуск. Дерматология 1998; 6: 363—367.
12. Самсонов В.А., Чистякова И.А. Новые препараты для лечения дерматозов. Вестн дерматол венерол 1999; 1: 46—48.
13. Федоров С.М., Гура А.Н. Иммунные механизмы развития аллергичсеких дерматозов. Вестн дерматол венерол 1999; 6: 11—14.
14. Schmitt J., Schäkel K., Schmitt N., Meurer M. Systemic treatment of severe atopic eczema: a systematic review. Acta Derm Venereol 2007; 87: 2: 100—111.
15. Bornhövd E.C., Burgdorf W.H., Wollenberg A. Immunomodulatory macrolactams for topical treatment of inflammatory skin diseases. Curr Opin Investig Drugs 2002; 3: 5: 708—712.
16. Сергеев Ю.В., Иванов О.Л., Новиков Д.К. Атопический дерматит: современная диагностика и лечение. Иммунопатол, аллергол, инфектол 2001; 4: 28—48.
17. Кунгуров Н.В., Кохан М.М., Кениксфест Ю.В. и др. Об оптимизации терапии больных атопическим дерматитом детей и взрослых. Вестн дерматол венерол 2004; 3: 23—29.
18. Molecular Cloning. A laboratory manual. J. Sambrook, E.F. Fritson and T. Maniatis (Ed.). Cold Spring Harbor Laboratory Press 1989.

 Здоровый образ жизни с современными технологиями Соглашение об использовании 
o1
Справочник »» Подробно о лекарствах »» Акрихин »» Дерматология